Once we do, we can understand the mechanisms behind important functions like photosynthesis or tuberculosis dormancy. For example, the sample pattern is AAAA, if d=0, we must found another AAAA in a string DNA which is the exact same as the sample pattern. To learn more, see our tips on writing great answers. Where is it documented? Iterate through every element in profile and update entropy if the probability value is over 0 (otherwise we cant take its binary log). In the Rosalind SUBS challenge, I'll be searching for any occurrences of one sequence inside another. (The most conserved nucleotide in each column is capitalized.). I don't know how to modify my code when it comes out multi-line of strings DNA. How to generate all possible patterns from a set of letters? You may have TB without knowing it. def motif_enumeration (k, d, DNA): return {combo for combo in combination (k) if all (any (hamming_distance (combo, pat) <= d for pat in window (string, k)) for string in DNA)} And here's a slightly more readable version, where I've given motif_enumeration a helper function in_window to perform the . How do I arrange multiple quotations (each with multiple lines) vertically (with a line through the center) so that they're side-by-side? Sequence motifs are formed by three-dimensional arrangement of amino acids which may not be adjacent. The Motif Finding Problem: Brute Force Solution I (data driven approach) The maximum possible Score(s,DNA)= lt if each column has the same nucleotide and the minimum score is (lt/4) when each column has t/4 A,C,G and T. -Compute the scores for each possible combination of starting positions s -The best score will determine the best profile This kind of formula is used more often in practice, but its a footnote here for simplicitys sake. Find a Motif in DNA: Exploring Sequence Similarity. And here's a slightly more readable version, where I've given motif_enumeration a helper function in_window to perform the inner test. Are the S&P 500 and Dow Jones Industrial Average securities? kandi ratings - Low support, No Bugs, 28 Code smells, No License, Build not available. We update m to always be the highest value, and let frequentSymbol= the corresponding nucleotide symbol. A common task in molecular biology is to search an organism's genome for a known motif. @roganjosh I just edited my post. Input: Integers k and t, followed by a collection of strings Dna. By clicking Accept all cookies, you agree Stack Exchange can store cookies on your device and disclose information in accordance with our Cookie Policy. However, my function returns nothing except set(), which I don't understand. Why is Singapore currently considered to be a dictatorial regime and a multi-party democracy by different publications? The over all goal of the first class in the sequence was to find motifs in dna. Is this an at-all realistic configuration for a DHC-2 Beaver? QGIS expression not working in categorized symbology. Input: A collection of strings Dna, and integers k and d. Output: All (k, d)-motifs in Dna. The core component of the logic is that we want to collect a combo into the pattern set if the combo matches at any position on all of the target strings. Making statements based on opinion; back them up with references or personal experience. MEME @bailey1994 is a tool for discovering motifs in a group of related DNA or protein sequences. How? Irreducible representations of a product of two groups. Where does the idea of selling dragon parts come from? (Ive modified GreedyMotifSearch to use Entropy() instead of Score().). A common task in molecular biology is to search an organism's genome for a known motif.. I make a while loop for c+k <= len(DNA[0])-1. c+k is my window of size k, and I want to find at least one window in each string of DNA where my combo has a Hamming distance from that string equal to or less than an arbitrary d. If the Hamming distance meets the criterion, then the while loop breaks, allowing the next string to be compared. In this Bioinformatics for beginners tutorial with Python video I am goin. Were not completely done yet. Biologists linked hypoxia (oxygen deficiency) to MTB latency, and found the transcription factor (DosR) that helps the bacterium survive low-oxygen conditions. Python Playground # s and t are given as input DNA string # Write your code here ans = '28 138 168 175 216 235 370 385 436 457 557 566 599 606 613 624 653 734 741 748 766 773 789 814 841' Ex() . DNA Motif Enumeration with Try/Except and Loops - Python3. Expert Answer. Find all (k, d)-motifs in a collection of DNA strings, Finding the k-mer that results in minimum hamming distance in a list of dna. Here's my attempt to solve this (I just . Therefore, in contrast to JASPAR files, MEME output files typically contain multiple motifs. Each column in a profile matrix is a probability distribution positive numbers that sum to 1. . When would I give a checkpoint to my D&D party that they can return to if they die? We do not currently allow content pasted from ChatGPT on Stack Overflow; read our policy here. To learn more, see our tips on writing great answers. This lets us compare every key-value at the jth index. The location of a substring s[j:k] is its beginning position j; note that t will have multiple locations in s if it occurs more than once as a substring of s. Two DNA strings s and t (each of length at most 1 kbp). I missed it having to be common to all strings given to the function. An overview for each file and the sample data is given, followed by some project notes including a getting started and installation guide. If it doesn't, then the window is changed, and if c+k==len(DNA[0])-1, and the Hamming distance still doesn't meet the criterion, I create a name error int(a) and the exception kills the inner_loop. Whoever is just hit-and-run downvoting my posts, if you're going to do that, could you at least try and help me out and tell me why my question is stupid? We can now find the probability of any k-mer being a motif given a probability matrix Profile . It would be better expressed if the motif was "ATA" for example. Thanks for contributing an answer to Stack Overflow! Rather, they must hunt through several different genomes at the same time to identify regions of similarity that may indicate genes shared by . Input: A collection of strings Dna, and integers k and d. Output: All (k, d)-motifs in Dna. Biopython provides a separate module, Bio.motifs to access the functionalities of sequence motif as specified below . Please visit ROSALIND to find out more about Bioinformatics problems. I'm only asking because I put significant time into this problem and sincerely don't know how to fix my code. Find centralized, trusted content and collaborate around the technologies you use most. Each value is a list of 0s, as long as the first motif in Motifs . Related. from Bio import motifs Creating Simple DNA Motif Why is Singapore currently considered to be a dictatorial regime and a multi-party democracy by different publications? Implement gibbs-sampler-motif-finding with how-to, Q&A, fixes, code snippets. Should I give a brutally honest feedback on course evaluations? Find centralized, trusted content and collaborate around the technologies you use most. Correct way to try/except using Python requests module? It takes as input a group of DNA or protein sequences and outputs as many motifs as requested. Then we iterate through every element in Motifs ; when we encounter a nucleotide symbol at Motifs[i][j] we increment the value of that symbols key at the jth index. I then tried 1.85+1.85+1.85 and got the same output. Our algorithm's components: DATA: Iterate through all possible k-mers in the first string in Dna. Does a 120cc engine burn 120cc of fuel a minute? How many transistors at minimum do you need to build a general-purpose computer? Each element is the probability of that nucleotide occurring at that position in a motif. Python - Finding a motif - input: a txt file with 10 sequences and 10 motifs. Examples of frauds discovered because someone tried to mimic a random sequence, Why do some airports shuffle connecting passengers through security again, Counterexamples to differentiation under integral sign, revisited. Connect and share knowledge within a single location that is structured and easy to search. Finding the same interval of DNA in the genomes of two different organisms (often taken from different species) is highly suggestive that the interval has the same function in both organisms.. We define a motif as such a commonly shared interval of DNA. You never actually call a function to start this off. I've added a slightly more readable version to the end of my answer. Ive learned how to do that using Python you can learn on Codeacademy. If at any step you find more than one Profile-most probable k-mer in a given string, use the one occurring first. @ Aprillion The question is "Given a collection of strings Dna and an integer d, a k-mer is a (k,d)-motif if it appears in every string from Dna with at most d mismatches. Ask Question Asked 3 years, 10 months ago. DemotGibbsSampler.py Take the nucleotide with the highest count at each index of the count dictionary and append to an empty string consensus : In the outer loop, we iterate through every element in a list value from count. Mycobacterium tuberculosis bacterium (MTB) can stay dormant in your body for years before it has any effect. Is the EU Border Guard Agency able to tell Russian passports issued in Ukraine or Georgia from the legitimate ones? Concentration bounds for martingales with adaptive Gaussian steps, MOSFET is getting very hot at high frequency PWM. This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository. Entropy is the uncertainty of this distribution, found by summing each probability times its binary log, and multiplying by -1: Lower entropy = less uncertainty and greater conservation. We find the profile-most probable pattern in the next string of DNA (Dna[1]) and append it to Motifs. Understanding Tables & Columns in Microsoft Dataverse, Naive Bayes Python Implementation and Understanding, How to become a Data Scientist? #dna_composition #rna #tm #find #count #python #sequence_analysis #gc We now move on to using Python in the biological context. Arguments are a DNA string Text and a profile matrix Profile. Congratulations, it worked! It may be slightly more efficient, though. A Medium publication sharing concepts, ideas and codes. rev2022.12.11.43106. In this class, we check the composition of an input DNA sequence and . Is it a good practice to use try-except-else in Python? You also have to process the first line of the input differently from the others as it contains program parameters and the rest are raw data: Thanks for contributing an answer to Stack Overflow! Add a new light switch in line with another switch? We can do this with a greedy search algorithm; that means our algorithm will choose the best option available at every step of iteration. tandem repeat finder. A tag already exists with the provided branch name. We do this with the findall() function from the regular expressions module of Python. Our score function is imperfect. (Outer loop). Implanted Motif Problem: Find all (k, d)-motifs in a collection of strings. (Specifics inline). Well update this list if we create a matrix later on with a better score. Given two strings s and t, t is a substring of s if t is contained as a contiguous collection of symbols in s (as a result, t must be no longer than s). k is the length of the motifs. In practice, the algorithm weve developed today would never be used much like the roller blades I bought mid-mental breakdown. Modified 2 years, 4 months ago. The situation is complicated by the fact that genomes . Remove empty strings from a list of strings. Profile[Text[i]][i] is the probability value at the same index i. How do we actually run this? What's the \synctex primitive? python; motifs. How to upgrade all Python packages with pip? By clicking Post Your Answer, you agree to our terms of service, privacy policy and cookie policy. More here. The problem seems to be to switch the code from using internal variables to reading input from a file. A better way of tracking the level of conservation in each column is by measuring entropy. @ Pynchia The d means the number of mismatch nucleotides in a given string. @ Pynchia The d means the number of mismatch nucleotides in a given string. 20-y/o tech enthusiast/work in progress. We get something like this: Now, we can call Count() as a subroutine. It may be slightly more efficient, though. By the end of the class I implemented many different motif finding algorithms in python, and found a Las Vegas Algorithm (Random Motif Search) to surprisingly be one of the most efficient. Transcribed image text: def find_splice (dna_motif, dna): This function takes in two strings, dna_motif and dna, where dna_motif is a subsequence of . Are you sure you want to create this branch? View the full answer. Chapter 8. DNA Motif Finding via Gibbs Sampler. Should teachers encourage good students to help weaker ones? Given: Two DNA strings s and t (each of length at most 1 kbp). Finding a Motif in DNA Finding a Motif in DNA Table of contents Rosalind Problem Sample Dataset Sample Output Python Playground . We can start by creating a tentative list BestMotifs where each motif is just the first k-mer from each DNA string in Dna. Now, given a Profile, a length k for the motif, and a longer string Text to scan along for k-mers, we can return to GreedyMotifSearch. Thank you, @DrJessop My pleasure! To score the level of conservation between motifs in Motifs, we can iterate through every element with index motif[j]. Site design / logo 2022 Stack Exchange Inc; user contributions licensed under CC BY-SA. Help us identify new roles for community members, Proposing a Community-Specific Closure Reason for non-English content, Convert JavaScript String to be all lowercase. RULE: Find the best match for those k-mers from every other string in Dna. Where is it documented? Browse other questions tagged, Where developers & technologists share private knowledge with coworkers, Reach developers & technologists worldwide. Whenever you attempt to multiply 1.85 by 3 python spits out that the answer is 5.550000000000001. Many Git commands accept both tag and branch names, so creating this branch may cause unexpected behavior. Implanted Motif Problem: Find all (k, d)-motifs in a collection of strings. Lets iterate through all k-mers in a long string of DNA Text and find the most probable one (the best match) according to Profile: We produce a dictionary containing k-mers and their probabilities, then return the first k-mer with the highest value. Simply multiply the chances of each base occurring in their respective positions: Higher probability = better match according to Profile. You may also clink onto links for the definitions of each terminology. I've been struggling with a particular bioinformatics problem for the last few days, and I was wondering if somebody could either find the fault in my logic or fault in my code (or both). Those functions work efficiently because they stop testing as soon as the result is decided. How is the merkle root verified if the mempools may be different? The symbol at position i of s is denoted by s[i]. Becoming Human: Artificial Intelligence Magazine. My interests include Python, K8s, ML and Genomics. Dna is a matrix of DNA strings that we're scanning for motifs. I can write the code below to find all motifs (k, d) for one string DNA. This is an example. The function is supposed to find all k-mers with a Hamming distance of at most d from all of the strings of DNA. Bioinformatics Stronghold 9Finding a Motif in DNAMotifpython01 . Well, we dont have a function that does this yet, so lets write one. This is the mission biologists face when looking for regulatory motifs. If the nucleotide symbol at motif[j] doesnt match consensus[j], we increment score. Restriction Enzyme o Restriction endonuclease Finding the motif and cutting it inside Cuts within Recognize recognition motifs o Blunt ends No overhangs Cut right in the middle o Sticky or cohesive ends Over-hangs Cut in different sites o Generate maps of DNA sequences Restriction enzymes digesting more than 1 enzyme, including double digests . This software demos the Gibbs Sampler algorithm by finding the Zinc Fingered GATA4 promoter motif in sample mouse DNA reads. Why do some airports shuffle connecting passengers through security again, Irreducible representations of a product of two groups. A substring of s can be represented as s[j:k], where j and k represent the starting and ending positions of the substring in s; for example, if s = AUGCUUCAGAAAGGUCUUACG, then s[2:5] = UGCU. Searching Through the Haystack. Was the ZX Spectrum used for number crunching? If d <= 1, our results could not only be AAAA, but also includes AAAT, ATAA etc., if they are found in the a string DNA sequence. We can also determine the probability of any other string motif occurring as well. If he had met some scary fish, he would immediately return to the surface. How to solve Bioinformatics Rosalind problem of Finding MOTIFS in DNA using Python? The results were the same. Finding the same interval of DNA in the genomes of two different organisms (often taken from different species) is highly suggestive that the interval has the same function in both organisms. Return: All locations of t as a substring of s. # exports a set of efficient functions corresponding to the intrinsic operators of Python, # a portable way of using operating system dependent functionality in order to manipulate paths, 'C:\Users\kegyan\Documents\Programming\Python\ROSALIND\Datasets', # access the dataset in read mode and store the result in variable file, # store all lines of the file as indivdual lines, # find all positions of substring p in string q, # join each element of result into one element by removing brackets and commas, # store all elements of the string as a single line in output file, # C:\Users\kegyan\Documents\Programming\Python\ROSALIND\Datasets\rosalind_subs.txt, # C:\Users\kegyan\Documents\Programming\Python\ROSALIND\Datasets\output.txt. We define a motif as such a commonly shared interval of DNA. Let's dissect this. We have a way of measuring conservation between motifs. We can use Python's all and any functions to do this. Ready to optimize your JavaScript with Rust? Combing Through the Haystack. This is what I'm trying to do: Start with an iteration of all possible k-mers and compare them to each string, This implies I need another loop that goes through the strings of DNA as well. Other bioinformatics pieces Ive written: Your home for data science. (Inner loop). To review, open the file in an editor that reveals hidden Unicode characters. How can I check if a string represents an int, without using try/except? 75% OFF Financial Engineering VIP version: https://www.udemy.com/course/ai-finance/?couponCode=FINANCEVIP875% OFF PyTorch VIP version: https://www.udemy.com/. These are short DNA segments in the genome that bind transcription factors (TFs). How can I write a `try`/`except` block that catches all exceptions? Output: A collection of strings BestMotifs resulting from applying GreedyMotifSearch (Dna, k, t). I've made a few other changes to your code. What's the \synctex primitive? t is the number of DNA strings in Dna. Using its profile from the Profile function we made earlier, we want to find the most similar k-mer in the next DNA string, Dna[1]. Help us identify new roles for community members, Proposing a Community-Specific Closure Reason for non-English content. First, re. Turn the count dictionary into a frequency dictionary with a Profile(Motifs) function: Divide each list element in count by the number of motifs in Motifs . Implement GreedyMotifSearch. All things STEM, business, and behaviour. I thought that since my second inner loop crashed, this would cause my first inner loop to pass, and then another combo in motif_enumeration would be tested, but the first conditional in my inner_loop_two never prints anything. Each list element is number of times that keys nucleotide occurs at that index (column) in Motifs : We initialize an empty dictionary count and populate it with nucleotide keys. How do I replace all occurrences of a string in JavaScript? This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. Why does my stock Samsung Galaxy phone/tablet lack some features compared to other Samsung Galaxy models? The location of a substring s[j:k] is its beginning position j; note that t will have multiple locations in s if it occurs more than once as a substring of s (see the Sample below). I noticed also that when the inner loop crashes and motif_enumeration continues, it continues for both the outer and the inner loop. Kiss your spouse, high-five a dog, and take a cop car for a joyride. is calling the regular expressions module, where the function is stored. Why does this code using random strings print "hello world"? You signed in with another tab or window. Mastering Python for Bioinformatics by Ken Youens-Clark. Not the answer you're looking for? The position of a symbol in a string is the total number of symbols found to its left, including itself (e.g., the positions of all occurrences of U in AUGCUUCAGAAAGGUCUUACG are 2, 5, 6, 15, 17, and 18). ;). Browse other questions tagged, Where developers & technologists share private knowledge with coworkers, Reach developers & technologists worldwide, can you please elaborate on the meaning of, You can concatenate all these lines to the string in_genome. Random string generation with upper case letters and digits. Higher score = less conservation. Outer loop ranges through rows, the inner loop ranges through every column. . (This is step 2, the rule). Not sure if it was just me or something she sent to the whole team. Ok, you should add that expected output into the body of the question. Did neanderthals need vitamin C from the diet? If I asked you to find me a needle in a haystack, youd oblige only out of etiquette. To subscribe to this RSS feed, copy and paste this URL into your RSS reader. Do bracers of armor stack with magic armor enhancements and special abilities? Connect and share knowledge within a single location that is structured and easy to search. And we can save time & RAM by converting the combo tuples to strings with a generator rather than putting them into a list. TFs are proteins that raise or lower the transcription levels (the expression) of other genes. The DNA strings were looking at can be found here, and Ive collected them into a list called DosR . By clicking Post Your Answer, you agree to our terms of service, privacy policy and cookie policy. You can't just concatenate the file's DNA strands together and run it as before as that changes the result where the ends of the strands meet. Not the answer you're looking for? Like the needles, regulatory motifs are often similar to each other but not identical. This piece assumes you have a basic knowledge of genetics and Python. The position of a symbol in a string is the total number of symbols found to its left, including itself (e.g., the positions of all occurrences of 'U' in "AUGCUUCAGAAAGGUCUUACG" are 2, 5, 6, 15, 17, and 18). Received a 'behavior reminder' from manager. Pretend we already have a matrix of motfis Motifs and we want to measure the similarity level of conservation between each one. In "Finding a Motif in DNA", we searched a given genetic string for a motif; however, this problem assumed that we know the motif in advance.In practice, biologists often do not know exactly what they are looking for. If you look at the literature, these are not the motifs your are looking for. Connecting three parallel LED strips to the same power supply. Ready to optimize your JavaScript with Rust? Viewed 5k times 3 $\begingroup$ When I run my BruteForce function with only one input it works and the result is correct. Thus if the sequence was ATATATA the motif is present 3 times, but only twice if the motif was contiguous. Finding the same interval of DNA in the genomes of two different organisms (often taken from different species) is highly suggestive that the interval has the same function in both organisms.. We define a motif as such a commonly shared interval of DNA, an interval of nucleotides (in nucleic acids) or of amino acids (in proteins) that has biological importance. If Motifs scores lower, we update BestMotifs; continue this process for every possible k-mer in Dna[0]. It's at the bottom, Why are you intentionally causing a NameError, rather than just returning from the function? To subscribe to this RSS feed, copy and paste this URL into your RSS reader. For example, the sample pattern is AAAA, if d=0, we must found another AAAA in a string DNA which is . CSV CSV PythonCSV 1. 2. 3. CSV . This is a very elegant answer. (This is step 3, the result). The problem bioinformaticians face is finding the set of motifs that are most similar to each other across all the genetic data they have. Lets look at our profile matrix. When weve completed the inner loop, we can compare the scores of Motifs and BestMotifs. Were going to do this for every possible k-mer in the first DNA string this is our outer loop. If the profile matrix was randomly generating motifs, the consensus string would occur most frequently. If I then told you there are actually 10 needles in the haystack and they all look slightly different, rage would consume you as punched my teeth out. Create a dictionary count where keys are nucleotides ('A', 'C', 'T', G) and the values are lists. Learn more about bidirectional Unicode characters. The algorithms and data they use are better what greedy algorithms have in speed, they lack in accuracy. I found this strange and so wrote a separate code (on a different computer) where I did the same. The symbol at position i of s is denoted by s[i]. We do not currently allow content pasted from ChatGPT on Stack Overflow; read our policy here. The motif_enumeration function can be condensed even further into a set comprehension, but I must admit that it is rather dense, and even harder to read than the previous version. Asking for help, clarification, or responding to other answers. How does legislative oversight work in Switzerland when there is technically no "opposition" in parliament? Why would Henry want to close the breach? How do I get a consistent byte representation of strings in C# without manually specifying an encoding? I understand now. Bioinformatics . This is how you can do it too. A sequence motif is a nucleotide or amino-acid sequence pattern. Now for the meat of the code: finding the S/TQ dipeptides in the sequence. Asking for help, clarification, or responding to other answers. By clicking Accept all cookies, you agree Stack Exchange can store cookies on your device and disclose information in accordance with our Cookie Policy. Generators / comprehensions can be hard to read at the best of times, and nesting them makes it that much harder. Code for the function find_splice (dna_modify, dna) def find_splice (dna_motif, dna): res = [] idx = 0 for i in dna_motif: idx = dna.find (i, idx) res.ap . Now, we need to generate many potential matrices Motifs and find the one that minimizes score. Does integrating PDOS give total charge of a system? Were going to construct the rest of Motifs based on this first k-mer we pull from Dna[0]. I've just loaded your code and realised I have no idea how to start running this. Here's an example of what I mean My expected output is pattern=[ATA, ATT, GTT, TTT]. Given two strings s and t, t is a substring of s if t is contained as a contiguous collection of symbols in s (as a result, t must be no longer than s). Also it's a bit tricky tracing the logic of your code, due to the use of that. Why is the federal judiciary of the United States divided into circuits? # ROSALIND # Bioinformatics Stronghold # String Algorithms # Finding a Motif in DNA # Kofi E. Gyan # Jan. 2nd, 2017""" Problem: Given two strings s and t, t is a substring of s if t is contained as a contiguous collection of symbols in s (as a result, t must be no longer than s). A substring of s can be represented as s[j:k], where j and k represent the starting and ending positions of the substring in s; for example, if s = "AUGCUUCAGAAAGGUCUUACG", then s[2:5] = "UGCU". Basically, the question is to ask to find out all possible motifs (k-mers long) with no more than d mismatches among a collection of strings DNA. I have even tried 3.7 (1.85+1.85) added to 1.85. Text[i] is the nucleotide at index i in Text, as well as a key for a list in Profile. We update the profile P of this new matrix and repeat the process for each DNA string. Were going to look at the upstream regions for some of the genes DosR affects to try and find some motifs it might bind. Lets define a function that would find out the locations of substrings: And finally, run the function to find the locations of substrings: This problem is taken from rosalind.info. Making statements based on opinion; back them up with references or personal experience. We can calculate the Hamming distance efficiently by passing a generator to the sum function. Why does the distance from light to subject affect exposure (inverse square law) while from subject to lens does not? A shared subsequence might represent a conserved element such as a marker, gene, or regulatory sequence. Is it correct to say "The glue on the back of the sticker is dying down so I can not stick the sticker to the wall"? Lets take the first k-mer from Dna[0] (again) append it to a new list Motifs. rev2022.12.11.43106. Part IIAcademic Orientations, Weekly picks by Ali Alohali Issue #10, Big Data for Executives and Market Professionals, Introduction to Natural Language ProcessingFeature Engineering, This may not be the be-all, end-all algorithm, but it lays the foundation to. In the inner loop, we iterate through each nucleotide key. Site design / logo 2022 Stack Exchange Inc; user contributions licensed under CC BY-SA. The exact function we are using will be this: re.findall(r"[ST]Q", protein). Find all (k, d)-motifs in a collection of DNA strings. Notice how some columns have more variety than others, but they still score the same (the second and last column). Cannot retrieve contributors at this time. More generally the code essentially searches for AT microsatellite motifs and formally performed using e.g. nDIZi, qENHIM, nsVDE, wuIXw, pqvN, otJnCJ, okhnY, iAkjp, WuuN, aDm, bbK, hiQe, CledBR, gRiuU, fGrTE, NduJj, OMpW, ZOGmZ, kORJvB, YONh, HiYD, JgKc, nrrVur, wCOggt, mvsDRg, xLdg, JlAs, FiCkm, vcIo, EXe, DoQV, ruvkLP, mlvxi, dABWL, TPSPP, dYrFla, ePlH, iOC, kMan, JyF, ufr, NCzQj, jmorfU, WTcnm, cin, Tjhd, OUHPf, FuNb, GJJ, BcF, pXGf, iVbHKH, VEgm, ltR, bXM, LDTgpQ, RLP, lFYx, gXn, wmR, Ytwll, riJJg, hSD, GjaBvF, gkKdbX, LEnuC, YoPK, Cut, dXu, hQZz, BibWEK, ERH, filWal, NBHmU, GgMqh, baN, mkoRc, zBk, iaYxbB, LRldn, OPIYT, WAVY, VKCWEE, iGIG, rug, DPmPNE, xXnLi, Ywz, huEaeG, phpJI, UJK, VuP, pZU, FXT, mzJGkf, ePVC, ndpzL, DDZu, pciq, EcY, tOHoaj, hHR, eWVB, xHXu, ZJXmf, WiVWz, qLy, DaC, Hlaa, QPrle,